December 2017


Dr. Sampaio at Sydney Children’s Hospital was the lead physician for Alina’s care, Alina was induced into a coma, which was hoped would calm the issue. 3 days later she returned as if very little had happened.

When questioned about the ongoing virus Alina had a long history of, Dr. Sampaio said he had checked for these, and they weren’t present, adamant that wasn’t the problem. Again, the parents pointed out that a key turning point was the 18 month MMR and a dramatic difference in her health and Dr. Sampaio said he had checked for the virus associated with this too (Epstein–Barr virus) and that it wasn’t a concern either. Dr Sampaio even said he had requested a specialist test for the virus the Father had emailed about (a northern blot). This request did not happen, or was mentioned in the Hospital Notes

  • Human rhinoviruses (HRVs) and enteroviruses (HEVs) are leading causes of infection in humans. These 2 picornaviruses share an identical genomic organization, have similar functional RNA secondary structures, and are classified within the same genus because of their high sequence homology.
  • However, despite their common genomic features, these 2 groups of viruses have different phenotypic characteristics. In vivo, rhinoviruses are restricted to the respiratory tract, whereas enteroviruses infect primarily the gastrointestinal tract and can spread to other sites such as the central nervous system. However, some enteroviruses exhibit specific respiratory tropism and thus have properties similar to rhinoviruses

Source: New Respiratory Enterovirus and Recombinant Rhinoviruses among Circulating Picornaviruses – Caroline Tapparel et al.

Accordion Sample Description
  • HRV infection triggers the release of a variety of antiviral factors and cytokines, including bradykinin, IL-1β, TNFα, IL-6 and IL-8, activating and attracting granulocytes, dendritic cells, and monocytes at the site of infection. An antibody response to HRV infection also occurs with the development of serotype-specific neutralizing serum antibodies (IgG) and secretory antibodies (IgA) in the airways, detectable usually after one or two weeks after inoculation and maintained for at least one year 
  • The tropism of RVs is restricted to upper respiratory airways, except in some rare cases of disseminated disease, whereas EVs can infect a wide range of different cells and cause very diverse clinical syndromes. Diseases due to non-RV EVs range from febrile illnesses to myopericarditis, paralysis or encephalitis, with a significant number of complications and deaths. EVs are notably the most frequent cause of viral meningitis. However, some types of EVs are only found in the respiratory tract and cause RV-like symptoms, especially EVs from species C and D, and are consequently named respiratory EVs. Some have been shown to share characteristic traits of RVs, including instability at low pH (34 °C)

Source: Rhinoviruses and Respiratory Enteroviruses: Not as Simple as ABC – Léna Royston and Caroline Tapparel.

The testing of Viruses is done using RT-PCR, the hospital uses the Allplex Respiratory Panel.

Evaluation of Allplex Respiratory Panel 1/2/3 Multiplex Real-Time PCR Assays for the Detection of Respiratory Viruses (a.k.a All16, as used by the Sydney Children’s Hospital – 2018). 

Any16/FilmArray/FluA = comparison/reference PCR equipment. HEV = Human Enterovirus.

  • The positive and negative percent agreements and kappa value for each virus between All16 and Any16 ranged from 54.5-100.0%, 84.7-100.0%, and 0.57-1.00, respectively. FluA subtype results from All16 for 26 samples were consistent with those from FilmArray. Good agreement was observed between the two methods, except when analyzing human enterovirus (kappa value 0.70)
  • Results obtained using the newly developed All16 test showed good agreement with Any16 results. For each virus, the positive and negative percent agreement showed good results. However, slight discrepancies were observed for HEV and PIV3; discrepancies in HEV results might reflect low viral loads or primer competition. Any16 detected more positive results for HEV than that by All16
  • In conclusion, All16 showed reliable performance, but further studies are needed regarding human enterovirus analysis
  • …as well as being able to detect all 10 viruses in the real‐time RT‐PCR system with the exception of enteroviruses

A primer is used with (Real-Time) RT-PCR, this is a short sequence of specific RNA that ‘sticks’ to the opposite coded beginning of the virus RNA sequence. The primer is attached to a marker (usually a coloured dye) for confirmation of that particular named virus.
Incidentally the primer/probe used in recognition of the acute (+ve) Rhinovirus (CCCCTGAATGYGGCTAACCTTAAMCCTGC), is identical to the reverse (-ve) chronic Enterovirus (CCCCTGAATGCGGCTAATCC). 

Sources: Comparative evaluation of the seegene seeplex RV15 and real‐time PCR for respiratory virus detection – David F. Bibby et al and Evaluation of Allplex Respiratory Panel 1/2/3 Multiplex Real-Time PCR Assays for the Detection of Respiratory Viruses with Influenza A Virus subtyping – Jaehyeon Lee et al.

Non-cytolytic enterovirus infections are characterized by a decreased ratio of positive to negative strand viral RNA: whereas in normal acute enterovirus infections, this ratio is around 100:1, in persistence non-cytolytic infections, the ratio has a value closer to 1:1

Sources: Immunological and pathological consequences of coxsackievirus RNA persistence in the heart – Claudia T. Flynn et al and How does a lytic enterovirus infection persist and cause chronic disease? – Nora Chapman.

The +ve strand ‘acute’ RNA Rhinoviruses primer used in the testing equipment sticks to the ‘chronic’ negative strand HEV. The illness Alina was presenting with was most certainly chronic and progressive (evident very much in the GP’s notes) and had all the symptoms of an Enterovirus, also known as Herpangina, albeit a chronic variation. 

i.e. a chronic (slowly progressive) Enterovirus is reported as an acute (quick) Rhinovirus by the systems in place at Sydney Childrens Hopsital. Any minor changes in Amino Acids may be explained below

Many broad-specificity enterovirus real-time reverse transcription PCRs target conserved regions of the 5′-UTR. The sequence divergence in the subspecies occurs in regions that are targeted by these diagnostic assays and may interfere with recognition of the virus by the primers

Source: Acute Flaccid Paralysis Associated with Novel Enterovirus C105 – Liana M. Horner et al.

Enteroviruses are inclined to mutations in this forward strand region the 5’ is the start section of an RNA viral strand. (the end is termed 3’)

A study to confirm this was performed in 2019, with Hospital (in-house) typing RT-PCR (Canada) equipment inaccurately attributing 21 reported Rhinoviruses, specific off-site testing per sample confirmed 10 of these were actually one type of Enterovirus alone (EV-D68)

  • During one week in October, 10 patients were admitted with positive EV-D68 (5 adults and 5 children). In contrast, all 21 admitted patients who had specimens sent for typing had Rhinovirus
  • Most of the currently used nucleic acid amplification assays for respiratory viruses do not distinguish between Rhino and Enteroviruses because of their shared homology

Source: Inability to Locally Differentiate Rhinovirus/Enterovirus Results Impacts Infection Control Practices – Susan V Donelan.

  • EVs are associated with broad human pathologies, ranging from the common cold to neurological disorder (i.e., encephalitis, aseptic meningitis, and flaccid paralysis), cardiovascular damage (i.e., viral myocarditis and dilated cardiomyopathy), and metabolic disease (i.e., type 1 diabetes)
  • EVs have traditionally been considered to escape the infected cell by causing it to rupture. However, emerging evidence highlights the significance of EVs in being able to spread through non-lytic mechanisms [the cell doesn’t lyse = burst]
  • The limited RNA genome of EVs is sufficient to induce damage to various cell types across different tissues leading to broad human pathologies

Source: The Intertwined Life Cycles of Enterovirus and Autophagy – Yasir Mohamud and Honglin Luo.

  • Enteroviruses are the leading belief for metabolic diseases, primary Diabetes I
  • Individuals genetically deficient in antibody production can resist most viruses but are susceptible to chronic enterovirus infections; although many of these are echoviral, CVB encephalitis also has been noted. Adoptive transfer of immune serum sometimes, but not always, ameliorates disease. Second, recent work suggests that B cells may be an important site of early CVB replication in vivo, raising the possibility that these cells may contribute to the virus’ ability to establish or disseminate infection, and it is tempting to suggest that infection of these cells might contribute to the immunosuppression reported more than 20 years ago
  • We suggest that, in normal mice, the antibody response imposes on the virus the requirement that it alter its replication strategy, resulting in a 1:1 genome:antigenome ratio and undetectable infectious virus

Source: The Role of B Lymphocytes in Coxsackievirus B3 Infection – Ignacio Mena et al.

The scientific information cited above demonstrates that the hospital tests were unreliable and chronic EVs are normally only identifiable by clinical observation. Ennteroviruses are a classification of viruses that originate from the gut (Entero – from within), they are very closely related to Rhino (from the nose), they appear to share a evolutionary stable start-end Nucleotide sequence. Many commercial tests cannot distinguish between them.

In a landmark 2005 paper, Prof [Norma] Chapman discovered the mechanism by which a normal lytic enterovirus can get transformed into an aberrant non-cytolytic virus capable of producing persistent low-level infections. The mechanism of transformation involves mutations that the virus acquires during the acute infection in the host

Prof Chapman has shown that this chronic single stranded RNA virus exists as a complimentary template or polaroid version of its own acute RNA variation

Further studies by Prof Chapman demonstrate that the chronic virus nests in sites of immune privilege

Chronic Enteroviruses are “non-cylclotic”; they do not readily “lyse” (break open) the cell in part of their reproductive cycle, so cannot be detected by the majority of standard testing, and present themselves as a milder, but recurrent version of the same entero/rhino virus; the -ve (antigenome) strand RNA acts as a “seed” for the +ve strand, hence a repeated chronic viral infection. 

Given the testing equipment used, it would seem a chronic (slowly progressive) enterovirus would have been reported as an acute (quick) rhinovirus by the hospital’s tests.

Of course it is the responsibility of a specialist such as Dr. Sampaio to fully know the limitations and flaws of the available testing equipment, and he should have been especially vigilant given the high frequency of viral clinical observations made to him by the parents, the extensive history with the GPs, and other medical staff.

07/12 Parents very concerned with smelly/metallic breath, breathing issues and snoring.
Has been seen by ENT for recurrent croup and noisy breathing. Large tonsils and likely will need an LBO +/- tonsillectomy. Recommendation to consult sleep and respiratory.
Sleep to do sats run tonight. Agree large tonsils.

Croup
Previous episodes of focal seizures (? cause)
Gross motor delay
Snoring since infancy
Coughing since 6 months of age
– initially started with a febrile ilness, fevers resolved and cough continued
– seen by doctors/GP; mum always told lungs clear, given steroids and courses of antibiotics (Penicillin
V/Amoxycillin/erythromycin), nil improvement
– multiple episodes of croup/stridor; given Redipred for 3days, improved but this has recurred 7-8 times over the past year.
– has required adrenaline nebs + previously tried ventolin
– ventolin had no effect
– Coughing worse at night and she coughed throughout the winter months
– some improvement with warmer seasons
– currently cough is more moist, not barking in nature
– previous speech pathology reviews – ?pooling saliva
NPA – bocavirus and rhinovirus positive
Mycoplasma serology negative
Blood cultures + urine cultures negative
Induced for post dates, LCSC
Meconium at birth
Did not require any respiratory support at birth
Colicky baby
– nil issues with back arching/vomiting
2 previous episodes of gaging with puree feeds at around 12 months of age – turned blue, required back blows
Eating soft foods at home e.g. porridge/purees/soft chicken
Episodes of breath holding, perioral cyanosis when upset
Seizures; since Nov 2017
Delay in walking
Snores loudly, likes to sleep prone
weight; 65th percentile

 

13/01
She has continued to have generalised clonic movements throughout the day with left and right arms twitching along with right leg twitching. She did have lip smacking to this morning with supsided and has ceased since the midazolam was commenced

14/01
Seizures:
Ongoing bilateral clonic seizures overnight on midazolam infusion 4mcg/kg/min
Given x6 boluses of midazolam overnight due to increasing amplitude of clonic movements
Right arm, leg and left clonic movements (asynchronous)

During night witnessed to have 2x episodes of bilateral limb jerking to both upper limbs and right leg, seems most pronounced to right arm and right leg. – on both occassions amplitude of jerking reduced with 2 x midazolam bolus and appear to settle

Pt required 4 x bolus’ of Midazolam from 0200-0500hrs instructed by CICU Registrar due to increased irritability and prolonged seizure activity, jerking of right and left upper limbs and R lower limb which eventually took good effect and reduced jerking movements
Remains vacant although eyes open spontaneously.
Temperature has continued to fluctuate throughout the day. Temperature 37-38.6 Has had one bolus of midazolam this evening due to increased HR and seeming agitated and settled post this and HR reduced and appeared to settle to sleep.
has continued to have generalised twitching movements to both arms and right leg along with her lips twitching today and appears more pronounced today

Following this, dad had a strong discussion with Dr. Sampaio that the illness spread seemed to be exclusive to the left. The disease would progress sequential in a very predictable (and sequenced) pattern.

Her symptoms would start in the left eye “dancing” accompanied with wheezing and sweaty head.

She would then develop a distinct smell on her breath. After which she would then develop a cough, which developed further into stridor and croup. These events rose and calmed many times before the first seizure with no significant consequence, but were now migrating outwards, from the throat.

The first seizure was exclusive to (initially) the throat and (then the) left side of the lip and the MRI for the brain was shown to be clear. It was only the second and following seizure that included the arm and the brain, as seen on the MRI. Therefore, the illness was moving from throat to brain, not brain to throat.

It was most certainly originating and radiating from the throat outwards, something the parents had seen numerous times, and in a specific accumulative order

(This was also the order of the illness progression in the GPs’ notes of nearly 40 visits)

Sites with immune privilege are anatomical regions that are naturally less subject to immune responses than most other areas of the body. Immune-privileged sites include the central nervous system and brain, the eyes and the testes, placenta and foetus, thyroid, the liver, adrenal glands. Also some studies have shown the pancreas and cartilage to be sites, while some studies reject this. Even foreign antigens accessing these tissues do not generally trigger immune responses. The

Immune privileged sites are places in the body where foreign antigens are tolerated without evoking detrimental inflammatory immune responses

There are many videos of Alina and a “dancing eye” on her left which didn’t seem to concern her too much (video included within diary). This would come and go, as would her wheeze, tonsillitis, head sweats, fevers, HFMD, irritability, skin rashes, croup and sudden but brief jerking movements when hearing loud noises (in particular motorbikes, lawnmowers or V-engined cars)

Following this discussion Dr. Sampaio replied that he believed it was “starting from the brain, and not from the throat to the brain”. He refused to discuss this further and dismissed dad’s observations, he said no more and just walked away from the conversation. He made no note of this in the Hospital notes either.

We suggested that EV71 could enter the CNS by retrograde axonal transport in peripheral motor nerves and then spread further within the CNS by motor and nonmotor neural pathways. Based on these findings, we hypothesized that the virus may be able to use not only the motor components of spinal nerves but also cranial nerves to enter the CNS.

Source: Enterovirus 71 Can Directly Infect the Brainstem via Cranial Nerves and Infection Can Be Ameliorated by Passive Immunization – Soon Hao Tan et al.

However, the scientific paper quoted above suggests the virus can migrate along the facial (cranial) nerves to the Central Nervous System, then towards the synapsis (brain). In Alina’s case, the GP’s medical history shows it started in the eye, then chest and throat, before migrated to the brain. Unknowingly, but clearly explained to Dr Sampaio by the father at the time.

*Mitochondria Redistribution in Enterovirus A71 Infected Cells and Its Effect on Virus Replication, https://pmc.ncbi.nlm.nih.gov/articles/PMC6687804/ 2019.

Alina also had an electroretinogram (ERG) that showed some concerns with her vision, with the result “Temporal discs pallor. ?cause”

On 9 December, Alina was given a Continuous Positive Airway Pressure (CPAP) machine, this very clearly distressed her and was abandoned after little more than an hour’s use. She had another seizure that night on the 9th December – and was intubated, spending the next 10 days in ICU.

ICU admission 9/12/17 – 19/12/17: Represented from ward with status epilepticus. Due to ongoing laryngeal seizures and increasing midazolam requirements, intubated and ventilated. Ketogenic diet commenced. Pt successfully extubated with seizures stabilising.

Dr Farrar and I concerned Alina’s illness may represent early Rasmussens. Focal sz, mild dev delay + worsening function of L) arm (see Karen Herbert’s note). Another possibility is POL-G or a focal cortical dysplasia. FIRES possible but not typical. Focal vasculitis/PACNS seem less likely (Associate Professor of Neurology, Fellow of Neurology)

We are commencing high dose methylpred and briefly I have explained why we do this in the setting of status epilepticus (particularly focal)

Following course of high dose methyl prednisolone next treatment would be IVIG

During this, the parents reiterated to the doctors that Alina had a history of bad reactions to elevated sugar, which was easily identified as mum suffered the same. They noted that when mum ate something sweet like a mango, a rash would instantly appear and mum would control this with antihistamines. Given this, the parents had concerns about the IV glucose drip, which seemed to be elongating and worsening the seizures (when the flow rate changed, so did the seizure activity), regardless of the medicine being delivered.

The hospital notes over the following days stated:

10/12
I have spoken with genetics fellow Colina on the phone regarding ?rapid WES/epilepsy panel +/- advice regarding ?POLG.

11/12
No indication of metabolic disorder on biochemical investigations to date (Professor Clinical Geneticist & Genetic Pathologist)

On 12 December, Alina was started on the ketogenic diet, her blood sugar levels and ketone levels had to be monitored and documented every 4-6 hours with a skin prick test to avoid ketosis.

The ketogenic diet is a restriction of glucose to control the blood sugar level (BSL). The energy is replaced with increased fats. The BSL and ketone levels work roughly inversely with a high BSL corresponding to a lower ketone level and vice versa. The ratio is increased to reduce circulatory glucose.

*In 2022 The International Consensus Recommendations for the Management of NORSE and FIRES, a peer-reviewed publication on New-Onset Refractory Status Epilepticus (NORSE) and Febrile Infection-Related Epilepsy Syndrome (FIRES). “The most commonly identified cause is autoimmune encephalitis in which a person’s immune system mistakenly attacks its own organs”, the recommend treatments highlight the following; acceleration of the Ketogenic diet within the 1st week (standard practice is currently 3:1 or 4:1 ratio), IL‐1RAs or IL‐6 antagonists should be initiated (Anakinra), rituximab treatment should be initiated. https://pmc.ncbi.nlm.nih.gov/articles/PMC9828002/

Despite publication in 2022, this information was readily available, [or as intuitive management] in 2017 (and earlier). You will read, see and hear within this diary this is the exact treatment the parents were suggesting and struggling to establish over the next 4 months, and when it was done and the treatment proved successful, it also proved the Neurologists had chosen the wrong path of trying to establish this illness from an untreatable fatal genetic cause

On 13 December the hospital noted “No definite evidence of a lactate peak is identified.

Dr. Sampaio was focused on a mitochondrial (genetic) disease and started to talk about this openly with the parents, saying he had concerns regarding POLG, a type of mitochondrial protein/gene defect.

There was no supporting evidence of this either historically or in presentation since Alina had no elevated lactates, no physical abnormalities, no mental regression, and the illness seemed to be coming in waves.

On 14 December, a blood test revealed Glutamic Acid Decarboxylase anti-bodies (Anti-GAD), as significantly high – A marker related to type 1 Diabetes and Autoimmune Diabetes (The maternal family history has a strong association with this particular autoimmune disease, Grandma had several nerve related illness, and Alinas mum had developed hypothyroidism, and rapid eyesight deterioration during pregnancy). This case offers a very likely explanation for the observation that autoimmune diseases are often triggered by a virus; It challenges the belief that autoimmune diseases are not transmissible, It seems to be the same virus, but is dormant (and could have been for possibly decades). It is also treatable if recognised early enough!

Since the parents were present at every one of these the BSL/ketone tests, they could very quickly see a clear link between elevated BSL and seizure type activity and her overall condition. The numerically higher the BSL was, the more pronounced Alina’s symptoms in her arm were, and the parents were noticing it was related to elevated sugar at testing (the parents could actually guess the BSL level to 0.1 accuracy prior to testing based on the seizure-like activity present – in particular in her left arm).

They reported how responsive she was to the ketogenic diet to Dr. Sampaio and the team, expecting this would lead to development of this diet and towards a treatment and diagnosis, but they were ignored. To the parents it seemed ridiculous that since the neurologists could not yet identify the illness, that at least they should focus on the aspects of the treatment that they could control, and that was the arm tremors caused by an elevated BSL, which in turn could be controlled with the Ketogenic diet. This met considerable and unexplainable resistance

A lumber puncture was performed and a PCR test was used to test the cerebrospinal fluid (CSF) for enterovirus. It was negative (results below), but again the test was almost completely ineffective as the development of the illness is not typical to other enteroviruses.

Lumber puncture (CSF) PCR test result
  • CSF viral culture results for patients with EV 71-associated neurologic disease are reported to be positive for only 0–3% of cases. The sensitivity of EV-PCR of CSF samples from patients infected with EV 71 is also poor. The reason that EV 71 is difficult to detect in CSF samples is unclear
  • Possible explanations for this include the virus only transiently being present in CSF, a lower amount of virus being present in CSF, the EV-PCR assay used not having been optimized for detection of EV 71, and/or different neuropathogenesis manifesting than those exhibited by other EVs

Source: Enteroviral encephalitis in children: clinical features, pathophysiology, and treatment advances – Shikha Jain et al.

The hospital notes the following days said.

16/12
Extubated from induced coma

17/12
Patrick the father would like it known that he feels she could be ?allergic to sugar as Alina mum is

The parents had been trying to discuss concerns regarding sugar intolerance and other issues with neurologists for over a week and were being gaslighted. The parents now started to voice these concerns to nurses and other members of the hospital staff.

Dr. Sampaio had been shown multiple videos of Alina dancing and normal energetic exercise.

The neurologists did not seem to be listening to the parents’ experience, observations or medical history of Alina. The parents were becoming suspicious, so started making audio recordings of conversations with the Neurologists as often as possible, for the reason that maybe they were using terms the Neurologists could not relate to. (The neurologists were still guessing to a cause for the illness).

Audio recording from 17 Dec 2017

Noticing the hypersensitivity to sugar with some confidence, the parents were now starting to repeat again on some of the more unusual observations, although unaware of their significance. These included Alina’s frequent low grade fever at night; her nicknames “crazy hair” from her frequently sweaty head and “twitchy nitchy” (provoked by a loud noise like a car or motorbike Alina would make sudden jerking movements) as the first signs in the progressive and specific order towards a seizure.

Audio recording from 18 Dec 2017

The diet was unquestionably linked to the seizure, with sugar being a noticeable trigger. The first seizure also followed a week after the MMR vaccination, when she refused to eat solids, sore throat and irritability, until finally eating cake at a party. Even that the mum had a very similar issue with intolerance and reactions to sugar and overlapping symptoms to Alina. Alina was also very responsive to intravenous midazolam.

The parents could see seizure activity in Alina’s arm, it was significantly more pronounced with higher BSL levels (from testing) and less when the ketone levels were high.

On 19 December, Alina was discharged from ICU to ward.

19/12
Natural history of Alina’s seizures may be waxing/waning of seizures and not true response to any medication. However, diet appears to have worked to some extent thus far

20/12
Review H. Sampaio
Currently no prolonged periods of focal seizure
Alert, smiling and improving truncal tone
Noted few episodes of vomiting today (mostly post cough)
Desats overnight noted but not apnoeic- mother stimulates Alina to terminate
Restart KTG diet at 3.5:1 ratio today

We have done medication levels last night. Low carbemazepine, normal phenobarbitone
CSF repeated from last week- nil inflammation.
Rasmussens is a possibility of a diagnosis, however there is no evidence of inflammation. (neurotransmitters normal)
Metabolic conditions- results are back. POLG negative. However they look only for 3 genes.
We are still waiting on the full exome results.
All other mitochondrial results have come back negative

The neurologists were attempting to substitute the high use of midazolam with diazepam and there was a noticeable negative change. Dad believed it was a reaction to diazepam (and not the withdrawal of midazolam, which had so far been incredibly effective) that was causing a noticeable change in Alina’s condition.

Dr. Sampaio was away on a short vacation, and the parents were strongly encouraging the staff to increase the ketone ratio (to positive effect), knowing this at least this worked.

Again, the father explained the association with sugar and symptoms, the sequence of events starting with loud noises, the family history of diabetes, the benefits of the ketogenic diet

Audio recording from 20 Dec 2017

The father noted to a friend in the UK via text “its like he [Dr. Sampaio] wants to prove this [genetic mitochondrial] disease and he will kill Ali to do it”.

On 21 December the hospital noted “Alina has had a good few days.”

The constants with the illness were; myoclonic jerks, fevers, vomiting, limb weakness, ataxia, tonsillitis, seizures, rashes and sweaty head, as well as a hypersensitivity to elevated sugar. In a particular order, the symptoms would escalate as mentioned before to Dr. Sampaio, from the the eye towards the lungs, and then from the throat outwards. She also reacted badly to loud noises (small rapid jerks), since birth.

Abnormal awake EEG due to diffuse background slowing plus right parasagittal slowing and intermittent epileptiform activity. Compared to an EEG performed six days ago the background has improved.

Download full notes here (JPG, 277k)

On 22 December the hospital notes said “Dad feels more confident and able to cope as Alina continues to show signs of ongoing improvement. Today she is smiling and interactive. Playing games and actively using her left arm.”

Dr. Sampaio mentioned the anti-GAD results to the parents and dismissed these results as the result of overlap with intravenous immune globulin (IVIG).

  • A GAD test is a blood test which measures whether the body is producing a type of antibody which destroys its own GAD cells. [Antigutamic Acid Antibodies]
  • In type 1 diabetes, a number of autoantibodies are thought to circulate including those which target glutamic acid decarboxylase.
  • Presence of these autoantibodies suggests type 1 diabetes

Source: BODYGAD Antibodies Test – Diabetes.co.uk.

Diabetic patients have a higher prevalence of thyroid disorders compared with the normal population. Because patients with one organ-specific autoimmune disease are at risk of developing other autoimmune disorders, and thyroid disorders are more common in females, it is not surprising that up to 30% of female type 1 diabetic patients have thyroid disease

Source: American Diabetes Association.

The following days the hospital notes said:

22/12
Possible Rasmussen’s Syndrome. Not mitochondrial. Studies still pending (Fellow Gastroenterology & Clinical nutrition fellow, Junior Medical officer)

23/12
Temp up to 38C this afternoon
Alert, smiling, no irritability

At this time Alina was being prescribed 5 different medications, at unprecedented doses approaching twice that of a fully grown adult.

24/12
Neuro consultant verbally informed nursing staff that Alina no longer needs to be High Acuity, yet to be documented

25/12
alina appears to be progressing

On 26 December, Alina had another seizure, on this occasion the parents requested an immediate BSL/ketone level check prior to administering any other medications, which may otherwise confuse the readings.

The Ketone test results clearly proved the suspicions regarding BSL, a point which the parents could not have been more vocal about beforehand but were stonewalled. Dad even wrote “seizure!” on the nurses notes (image above) so no confusion could be made. The sugar level stuck out as a significant marker to link and prove the seizures and the diet were associated. The parents had seen the glucose rise briefly above the BSL before and noticed significant seizure activity in Alina’s arm and wheeze. On this occasion at night, she had a full seizure.

However, the seizure was controlled very quickly by comparison to before, after which the ketone/BSL levels returned to the better ratio to previous episodes which involved admission to ICU.

The parents rang the head of department, Prof. Annie Bye with the evidence and requested to review the ketogenic diet ratio as there was an undeniable link.

Audio recording from 26 Dec 2017

In 2024 this was published;

Hyperglycemia facilitates EV71 replication: Insights into miR-206-mediated regulation of G3BP2 promoting EV71 IRES activity (2024 – Rai-Hua Lai et al)

 “…administering insulin alone to reduce hyperglycemia in hSCARB2-transgenic mice results in a decrease in brainstem encephalitis and viral load….”

The hospital noted “Patient has remained drowsy and asleep for most of the morning. Has jerk like movements with noise. Left arm continues to jerk, father reports has improved throughout morning.”

A meeting was held with Prof. Bye on December 27.

Audio recording of call from 27 Dec 2017

Prior to the formal meeting the father met with Prof. Bye and Dr. Denise and explained taking the BSL prior to administration of midzolam, also the maternal family history of diabetes and the origin of the “unknown illness” coming from the throat

The neurology department now could not avoid the demonstrated correlation, although they would not accept this easily. But at least they started to listen to the parents and increase further the fat:sugar ratio in Alina’s diet (4:1) and very strictly monitor sugar content from medications.

The neurology department had no idea as to what was causing the seizures and illness but agreed to listen to the parents’ experience that if the BSL was at 3.2 the seizure visual seizure activity in the arm was almost zero, at 3.9 it would be the upper limit of activity and would show in increased movements of Alina’s arm, beyond this and she tipped towards, or even into a seizure

Audio recording of meeting from 27 Dec 2017

Following this, the dietician visited the parents to discuss improvements. The parents were requesting information on how to deal with the fluctuations and wanting a reserve of a higher ratio (4.5:1) when the BSL reached the upper limits to use as a temporary fix. The dietician could not answer confidently, and the parents became more frustrated with her.

Within minutes of her leaving (visually upset at the questioning), Prof. Bye arrived abruptly and claiming she was just “passing” but the timing was clearly minutes after the dietician left. She confronted the parents and they had a heated argument about several matters regarding Alina’s care, including the diet ratio, as they felt the dieticians were not responding in providing an improved ratio quickly enough and wanted a reserve temporary action plan to counter the sugar level approaching the seizure threshold (of BSL 3.9) to reduce it.

Prof. Annie Bye was insistent “they knew what they were doing”.

Another aspect of complaint was the parents did not feel the neurology department was acknowledging the progress and history of the illness, and the parents were now asking questions outside of the hospital.

Prof Bye was adamant the parents were not to discuss the matters or history of Alina with anybody but the neurology department. She informed them that if they have any questions they only write them down and present them to a member of the neurological team and nobody else. The parents were losing faith in the ability of the department. Prof. Bye aggressively threatened the parents “you have to be very careful how you talk to Doctors, you need to watch yourself!” as her parting words.

However, the ketogenic diet was recognised and monitored far more closely after 27 December, and the relationship with seizures was very much established with the controlling ketogenic diet ratio now at 4;1 stabilising the seizure activity. The neurology team was now going to great lengths to protect the sugar intake (even later sourcing IVIG that was sugar free) and the parents felt they didn’t need to press the neurology department constantly on this issue anymore.

In the last week of December, the hospital had Alina on a low sugar diet, she was making significant improvements and was playful and making good recovery. Noticeable seizure activity in her was apparent during dips in her ketone levels (and elevation of her sugars), but they were comparatively short lived

There were plans to discharge the family once Alina had her enlarged tonsils removed on 18 January, when the surgeons returned after the Christmas vacation.

The hospital stated in their notes:

28/12
Parents felt that L sided jerks were more pronounced when ketones lower – similar to when seizures first recurred onBoxing Day
Now improved
Awaiting tonsillectomy as a treatment for OSA

Audio recording from 30 Dec 2017

30/12 
alina generally happy and smiling when wakes currently sleeping

Dad reports that Alina has had increased twitching of her left arm, a few head drops, and some bubbling at the mouth. Not the same as her normal raspberries that she blows when she is being friendly. Ketones checked at this time and were 5.1. Dad would like it to be noted that they think ketones <5.5 tend to coincide with her symptoms being worse
Also reports that sometimes Alina will have increasing amounts of twitches and head drop when she is nervous or tired

Doing well
Slept from 11pm after melatonin
Woke ovrnight when overnight meds given
Ketones and sugars in good range
EPC ongoing clinically

31/12
Alina with EPC
Ongoing left arm jerks
Parents report more evident in the evening coinciding with ketone dipping
Ketones late evening and in morning can be below 5

Download full notes here (PDF, XXXk)

Audio recording from 31 Dec 2017